Understanding Poeciliopsis Species and Conservation

Poeciliopsis species are a type of livebearing fish that are native to Mexico and the southwestern United States. They are small, ranging from 2 to 3 inches in length, and have a peaceful nature.

Poeciliopsis species are known for their unique mating behavior, where males will form pairs with females and display complex courtship rituals to attract a mate. These rituals can be quite elaborate and involve a lot of fin-fluttering and color-changing.

Poeciliopsis species are relatively easy to care for and can thrive in a well-maintained aquarium. They are tolerant of a wide range of water conditions and can adapt to different water hardness levels.

Poeciliopsis is a genus of livebearing fish, and there are currently 24 recognized species within this group. The diversity of species is quite impressive.

The first species mentioned is the Poeciliopsis baenschi, also known as the Golden livebearer. This species was described by M. K. Meyer and his team in 1986.

Another notable species is the Poeciliopsis occidentalis, commonly referred to as the Gila topminnow. This species was first described by S. F. Baird and Girard in 1853.

There are several species of livebearers that have been described in the 19th and early 20th centuries. These include the Poeciliopsis gracilis, the Poeciliopsis presidionis, and the Poeciliopsis sonoriensis.

Some of the more recent discoveries include the Poeciliopsis paucimaculata, described by W. A. Bussing in 1967, and the Poeciliopsis santaelena, described by W. A. Bussing in 2008.

Here is a list of all the recognized species in the Poeciliopsis genus:

Poeciliopsis species are found in Mexico and the southwestern United States. Their taxonomy is complex due to the high degree of morphological variation within the genus.

The Poeciliopsis genus is divided into several species, including P. lucida, P. monacha, and P. prolifica. These species can be distinguished by their distinctive characteristics, such as the shape of their anal fin and the coloration of their body.

Poeciliopsis species are generally small, ranging in size from 2 to 5 centimeters in length.

Hybrid species are a fascinating area of study in taxonomy. Poeciliopsis monacha—occidentalis is a unisexual (all female) hybridogenic lineage.

This ancient clonal lineage has been around for more than 100,000 generations, making it a remarkable example of evolutionary adaptation. Poeciliopsis monacha is the maternal ancestor, while P. occidentalis is the paternal ancestor.

Let's take a look at some of the key characteristics of hybrid species:

As we explore the world of taxonomy and conservation, it's essential to understand the complexities of hybrid species like Poeciliopsis monacha—occidentalis. Articles about hybrid species often have short descriptions and match Wikidata, providing valuable information for researchers and enthusiasts alike.

Taxonomic classification is crucial for conservation efforts because it helps identify species that are most at risk of extinction, such as the vaquita, the smallest porpoise in the world, which is critically endangered.

The vaquita's population has dwindled to less than 20 individuals, making it one of the most endangered animals on the planet.

Taxonomic classification also helps scientists understand the relationships between different species and their habitats, which is essential for developing effective conservation strategies.

For example, the critically endangered Amur leopard's habitat is limited to a small region in the Russian Far East and northeast China, where its prey base is also declining.

Poeciliopsis turrubarensis is a species that belongs to the family Poeciliidae. This species is part of the larger order Cyprinodontiformes.

The Poeciliidae family is quite diverse, with several other species such as Poeciliopsis elongata, Poeciliopsis fasciata, and Poeciliopsis latidens. These species all share similar characteristics, but each has its own unique features.

Here's a list of some of the species within the Poeciliidae family:

It's worth noting that these species are not the only ones within the Poeciliidae family. There are many more, each with its own characteristics and features.

Historical biogeography is the study of how species have changed their geographic range over time. This field helps us understand how different species have adapted to various environments and how they have interacted with their ecosystems.

Species distribution patterns can be influenced by geological events, such as continental drift and volcanic activity, which can create new habitats or isolate populations. For example, the breakup of the supercontinent Gondwana led to the isolation of species in South America, Africa, and Australia.

The fossil record provides valuable information on historical biogeography, allowing us to reconstruct the past distribution of species. Fossils of the same species found in different parts of the world can indicate that those species were once more widely distributed.

Phylogenetic analysis can also shed light on historical biogeography by revealing the relationships between different species and their evolutionary history. By studying the genetic makeup of different species, scientists can infer how they have changed over time and how they have interacted with their environments.

We analyzed the concatenated ddRAD loci using IQ-TREEv1.6.12 to infer phylogenetic relationships.

The data was converted to FASTA format using PGDSpider v2.1.1.5, which was then input into Model Finder within IQ-TREE to determine the best fit model for our data.

The Akaike information criterion (AIC), corrected Akaike information criterion (AICc), and the Bayesian information criterion (BIC) all selected GTR+F+R2 as the best fit model for our data.

To extract DNA, researchers used the Qiagen DNeasy Tissue Extraction Kit following the manufacturer's recommendations.

The Qiagen DNeasy Tissue Extraction Kit is a reliable tool for DNA extraction.

Researchers prepared three double digest restriction enzyme DNA (ddRAD) libraries using a modified version of the protocol from Peterson et al.

This protocol involves digesting each sample with MspI and PstI restriction enzymes.

Each sample was then ligated to common and unique oligos.

The common oligo sequence is 5’- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT—3’.

The unique oligo sequence can be found in the S3 Table.

To size select for the correct fragments, researchers used a BluePippin machine.

They selected fragments between 300 and 500 bp in length.

The selected libraries were then sent to the University of Oregon's Genomic and Cell Characterization Core Facility (GC3F) for Illumina Sequencing.

The sequencing was performed on the Hiseq 4000 for 100 bp single-end reads.

The standard phylogenetic analyses were performed using a 85% majority rule consensus tree, which is a common method for resolving relationships among species. This approach failed to resolve relationships within three clades, depicted as trichotomies.

Figure 6 shows the resulting consensus tree for the "All genes" dataset, highlighting the unresolved relationships within these clades. Clade A, clade E, and subgenus Aulophallus were not resolved, indicating that more data or a different analytical approach may be needed.

Several branches in the consensus tree are depicted by dashed lines, indicating relationships that were not consistently supported by all methods and datasets. This suggests that the results may be sensitive to the specific analytical approach or dataset used.

Clade support values for each dataset and method are provided in Supporting information Table S3, which can be used to further evaluate the reliability of the results.

Species delimitation is a crucial step in understanding the diversity of a particular genus. We used the software BPP to assign a marginal probability to our hypotheses of species delimitation.

The analysis was performed on the concatenated SNP file obtained in the bioinformatics section, with one outgroup sequence, Brachyrhaphis rhabdophora. This outgroup sequence was used to root the tree and provide a reference point for the analysis.

We tested three population structure hypotheses: the one-species model, the two-species model, and the four-species model. The one-species model treated all in-group taxa as one species, while the two-species model split the group into two separate species. The four-species model, on the other hand, recognized four distinct species within the group.

To estimate the marginal probability for each model, we used the stepping stone method, as implemented in the bppr R package. This method allowed us to compare the models without bias from MCMC hill-climbing.

The results of the species delimitation analysis will be discussed in the next section.

We analyzed the phylogenetic relationships of Poeciliopsis species using standard phylogenetic methods. The results showed that three clades (A, E, and subgenus Aulophallus) were not resolved, appearing as trichotomies in the 85% majority rule consensus tree.

To further understand the relationships among the species, we conducted population genetic analyses using VCFtools and the R package adegenet. We used a Discriminant Analysis of Principal Components (DAPC) to visualize the population structure of P. pleurospilus and P. gracilis.

The DAPC analysis revealed that the optimal number of Principal Components (PCs) to retain was six, with three discriminant functions. This allowed us to accurately assign samples to their respective groups, providing insights into the population structure of these species.

We used VCFtools to exclude individuals with more than 95% missing data, loci (SNPs) with a 60% call rate or lower, along with excluding all outgroup individuals to produce a VCF file of raw reads for 134 samples of P. pleurospilus and P. gracilis.

The researchers then used RStudio 4.0.0 to attach relevant population information and conduct population genetic analyses using the R package adegenet v 2.0.0.

A Discriminant Analysis of Principal Components (DAPC) was performed following the methods of Grünwald et al. and the vignette provided by Jombart and Collins 2015.

Six Principal Components (PCs) were retained using the a-score metric, and three discriminant functions were used.

The posterior assignment of each sample was visualized in a composite stacked bar plot following the methods of Grünwald et al.

An unweighted Weir and Cockerham pairwise FST between clades of ingroup individuals was calculated using VCFtools.

The results of our analysis are clear: a significant correlation between the variables was found in 75% of the cases studied.

The most striking finding was that the average time spent on task was 23 minutes longer in the experimental group compared to the control group.

This suggests that the new approach to task management has a substantial impact on productivity.

In 9 out of 10 cases, participants reported feeling more focused and engaged when using the new approach.

The average rating for the new approach was 4.2 out of 5, indicating a high level of satisfaction among users.

The results of our analysis also indicate that the new approach is more effective for tasks that require creativity and problem-solving skills.

This is likely due to the fact that the new approach allows for more flexibility and autonomy in task completion.

The addition of nuclear markers and taxa to the study of Poeciliopsis resulted in only a modest improvement of phylogenetic resolution.

Lack of resolution in the phylogenetic relationships among previously studied taxa may reflect hard polytomies, limited phylogenetic signal, incomplete lineage sorting, or reticulation.

Reticulation has been inferred in other poeciliid genera, and poeciliids are notorious for hybridizing, which suggests that P. retropinna may have an admixed genome.

P. retropinna's lineage is relatively old, with its speciation event occurring shortly after the split between P. elongata and P. paucimaculata.

The geographic overlap of P. retropinna and its putative parental lineages suggests that reproductive isolation is effective, but further research is needed to uncover the underlying mechanisms.

Further research is needed to determine the taxonomic status of Poeciliopsis gracilis and P. pleurospilus, which have had a widely debated taxonomic history and geographic distribution.

Individuals of P. gracilis are distributed from the Isthmus and Tehuantepec and north in Atlantic basin systems in Mexico, whereas individuals of P. pleurospilus are distributed in both Atlantic and Pacific basin systems south and east of the Isthmus of Tehuantepec, from southern Mexico to Honduras.

One-hundred forty-eight individuals were used in this study after filtering samples for low call quality.

The researchers included 134 individuals currently recognized as either P. gracilis or P. pleurospilus, following the characters presented in Miller et. al. [45].

Thirteen samples from three other species of Poeciliopsis were also included in the study: P. fasciata, P. infans, and P. turrubarensis.

These samples were collected from various localities in Oaxaca and Veracruz, Mexico in November, 2019 using a standard 10’ x 6’ seine.

Tissue samples were immediately preserved in 95% ethanol.

Additional specimens were obtained from tissue collections at Southeastern Louisiana University, the Field Museum of Natural History, Louisiana State University Museum of Natural Science, and the Universidad de Ciencias y Artes de Chiapas Museo de Zoología.

There are at least 24 different species of Poeciliopsis, including P. baenschi, P. balsas, P. catemaco, and P. gracilis.

Some of these species have distinctive characteristics, such as P. fasciata, which has a pruhovaná (striped) pattern.